Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDK4 Gene Lentiviral ORF cDNA expression plasmid(NM_000075.2)

Product Information

NCBI RefSeq: NM_000075.2

RefSeq ORF Size: 912

cDNA Description: Full length Clone DNA of Homo sapiens cyclin-dependent kinase 4.

Gene Synonym: CMM3,PSK-J3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDK4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid HG10732-UTLN pLV-untagged 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10732-CFLN pLV-C-FLAG 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10732-CHLN pLV-C-His 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10732-CMLN pLV-C-Myc 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10732-CYLN pLV-C-HA 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10732-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10732-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10732-NFLN pLV-N-Flag 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10732-NHLN pLV-N-His 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10732-NMLN pLV-N-Myc 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10732-NYLN pLV-N-HA 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10732-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDK4 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10732-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of CDK4 is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). CDK4 was shown to be responsible for the phosphorylation of retinoblastoma gene product. CDK4 is the ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. CDK4 has been shown to be mutated in some types of cancer, whilst a chromosomal rearrangement can lead to Cdk6 overexpression in lymphoma, leukemia and melanoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Stepanova L, et al. (1996) Mammalian p50Cdc37 is a protein kinase-targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev. 10(12):1491-502.
  • Lamphere L, et al. (1997) Interaction between Cdc37 and Cdk4 in human cells. Oncogene. 14(16): 1999-2004.
  • Dai K, et al. (1996) Physical interaction of mammalian CDC37 with CDK4. J Biol Chem. 271(36): 22030-4.
  • Sugimoto M, et al. (1999) Regulation of CDK4 activity by a novel CDK4-binding protein, p34SEI-1. Genes Dev. 13(22):3027-33.