Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid(NM_003948.3)

Product Information

NCBI RefSeq: NM_003948.3

RefSeq ORF Size: 1482

cDNA Description: Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase).

Gene Synonym: KKIAMRE,P56

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDKL2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid HG11191-UTLN pLV-untagged 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11191-CFLN pLV-C-FLAG 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11191-CHLN pLV-C-His 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11191-CMLN pLV-C-Myc 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11191-CYLN pLV-C-HA 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11191-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11191-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11191-NFLN pLV-N-Flag 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11191-NHLN pLV-N-His 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11191-NMLN pLV-N-Myc 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11191-NYLN pLV-N-HA 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11191-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDKL2 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11191-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

Reference

  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.