Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid(BC000644)

Product Information

NCBI RefSeq: BC000644

RefSeq ORF Size: 186

cDNA Description: Full length Clone DNA of Homo sapiens CD52 molecule.

Gene Synonym: CDW52

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD52 / CDW52 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid HG15105-UTLN pLV-untagged 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15105-CFLN pLV-C-FLAG 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15105-CHLN pLV-C-His 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15105-CMLN pLV-C-Myc 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15105-CYLN pLV-C-HA 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15105-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15105-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15105-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15105-NHLN pLV-SP-N-His 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15105-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD52 / CDW52 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15105-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.