Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid(BC121800)

Product Information

NCBI RefSeq: BC121800

RefSeq ORF Size: 1542

cDNA Description: Full length Clone DNA of Homo sapiens butyrophilin, subfamily 3, member A1.

Gene Synonym: BT3.1,BTF5,BTN3.1,CD277

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BTN3A1 / CD277 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid HG15973-UTLN pLV-untagged 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15973-CFLN pLV-C-FLAG 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15973-CHLN pLV-C-His 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15973-CMLN pLV-C-Myc 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15973-CYLN pLV-C-HA 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15973-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15973-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15973-NFLN pLV-SP-N-Flag 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15973-NHLN pLV-SP-N-His 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15973-NMLN pLV-SP-N-Myc 2-3 weeks
Human BTN3A1 / CD277 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15973-NYLN pLV-SP-N-HA 2-3 weeks

Background

BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a family of seven BTN receptors encoded by genes in the MHC. BTN molecules are composed of two Ig domains (IgV, IgC2), a single transmembrane domain, and a large carboxyl-terminal domain termed B30.2 (or PRYSPRY) located in the cell cytoplasm. There are three human BTN3A loci, BTN3A1, BTN3A2, and BTN3A3, and clear orthologs of BTN3A molecules, now called CD277, are absent from the mouse genome. Despite its similarity to B7 molecules, BTN3A1 was proposed to act not as a coreceptor or costimulatory molecule, but rather to directly present pAg to the

Reference

  • Rhodes DA, Chen H-C, Price AJ, et al. Activation of human