Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid(NM_007197.3)

Product Information

NCBI RefSeq: NM_007197.3

RefSeq ORF Size: 1746

cDNA Description: Full length Clone DNA of Homo sapiens frizzled family receptor 10.

Gene Synonym: CD350,FZ-10,Fz10,FzE7,hFz10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Frizzled-10/FZD10 (CD350) Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid HG16045-UTLN pLV-untagged 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG16045-CFLN pLV-C-FLAG 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG16045-CHLN pLV-C-His 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG16045-CMLN pLV-C-Myc 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG16045-CYLN pLV-C-HA 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG16045-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG16045-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG16045-NFLN pLV-SP-N-Flag 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG16045-NHLN pLV-SP-N-His 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG16045-NMLN pLV-SP-N-Myc 2-3 weeks
Human Frizzled-10/FZD10 (CD350) Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG16045-NYLN pLV-SP-N-HA 2-3 weeks

Background

Mouse Frizzled-10, also known as Fz-10, CD350 and FZD10, is a multi-pass membrane protein which belongs to the G-protein coupled receptor Fz/Smo family. Frizzled-10 / FZD10 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-10 / FZD10 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-10 / FZD10 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.

Reference

  • Kwon H.S., et al.,(2009), Myocilin is a modulator of Wnt signaling. Mol. Cell. Biol. 29:2139-2154.
  • The MGC Project Team, et al., (2004), The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC).Genome Res. 14:2121-2127.
  • Tanaka S., et al.,(1998), A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals.Proc. Natl. Acad. Sci. U.S.A. 95:10164-10169.