Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_152854.2)

Product Information

NCBI RefSeq: NM_152854.2

RefSeq ORF Size: 612

cDNA Description: Full length Clone DNA of Homo sapiens CD40 molecule, TNF receptor superfamily member 5.

Gene Synonym: Bp50,CDW40,p50,TNFRSF5

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD40/TNFRSF5 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG16492-UTLN pLV-untagged 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG16492-CFLN pLV-C-FLAG 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG16492-CHLN pLV-C-His 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG16492-CMLN pLV-C-Myc 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG16492-CYLN pLV-C-HA 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG16492-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG16492-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG16492-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG16492-NHLN pLV-SP-N-His 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG16492-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD40/TNFRSF5 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG16492-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.