Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid(NM_005433.3)

Product Information

NCBI RefSeq: NM_005433.3

RefSeq ORF Size: 1632

cDNA Description: Full length Clone DNA of Homo sapiens YES proto-oncogene 1, Src family tyrosine kinase.

Gene Synonym: c-yes,HsT441,P61-YES,Yes

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human YES1/c-Yes Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid HG16953-UTLN pLV-untagged 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG16953-CFLN pLV-C-FLAG 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG16953-CHLN pLV-C-His 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG16953-CMLN pLV-C-Myc 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG16953-CYLN pLV-C-HA 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG16953-ACGLN pLV-C-GFPSpark 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG16953-ACRLN pLV-C-OFPSpark 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG16953-NFLN pLV-SP-N-Flag 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG16953-NHLN pLV-SP-N-His 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG16953-NMLN pLV-SP-N-Myc 2-3 weeks
Human YES1/c-Yes Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG16953-NYLN pLV-SP-N-HA 2-3 weeks

Background

Proto-oncogene tyrosine-protein kinase Yes, also known as Proto-oncogene c-Yes, p61-Yes and YES1, is a cytoplasm protein which belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. YES1 / c-Yes contains one protein kinase domain, one SH2 domain and one SH3 domain. It is thought that the subcellular distribution of Src-family tyrosine kinases, including c-Yes binding to the cellular membrane, is membranous and/or cytoplasmic. YES1 / c-Yes protein tyrosine kinase is known to be related to malignant transformation. YES1 / c-Yes and c-Src are the two most closely related members of the Src family of nonreceptor tyrosine kinases. Although there is much evidence to support redundancy in signaling between these two kinases. YES1 / c-Yes promotes formation of the tight junction by phosphorylating occludin, while c-Src signaling downregulates occludin formation in a Raf-1 dependent manner. YES1 / c-Yes has tyrosine kinase activity. It promotes infectivity of Neisseria gonorrhoeae in epithelial cells by phosphorylating MCP / CD46.

Reference

  • Summy,J.M. et al., 2003, Front Biosci  8 :s185-205.
  • Clump,D.A. et al., 2005, Growth Factors  23 (4):263-72.
  • Nonomura,T. et al., 2007,Int J Oncol  30 (1):105-11.