Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid(NM_000618.4)

Product Information

NCBI RefSeq: NM_000618.4

RefSeq ORF Size: 462

cDNA Description: Full length Clone DNA of Homo sapiens insulin like growth factor 1.

Gene Synonym: IGF-1,IGF-I,IGF1A,IGFI,IGF?I,MGF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IGF1/IGF‑I/IGF-1 transcript variant 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid HG29626-UTLN pLV-untagged 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG29626-CFLN pLV-C-FLAG 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG29626-CHLN pLV-C-His 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG29626-CMLN pLV-C-Myc 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG29626-CYLN pLV-C-HA 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG29626-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG29626-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG29626-NFLN pLV-SP-N-Flag 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG29626-NHLN pLV-SP-N-His 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG29626-NMLN pLV-SP-N-Myc 2-3 weeks
Human IGF1/IGF?I/IGF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG29626-NYLN pLV-SP-N-HA 2-3 weeks

Background

IGF I, also known as mechano growth factor, somatomedin-C, IGF-I and IGF1, is a secreted protein which belongs to the?insulin family. The insulin family, comprised of insulin, relaxin, insulin-like growth factors I and II ( IGF-I and IGF-II ) and possibly the beta-subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged. The IGFs, or somatomedins, constitute a class of polypeptides that have a key role in pre-adolescent mammalian growth. IGF-I expression is regulated by GH and mediates postnatal growth, while IGF-II appears to be induced by placental lactogen during prenatal development. IGF1 / IGF-I may be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. IGF1 / IGF-I stimulates glucose transport in rat bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. Defects in IGF1 / IGF-I are the cause of insulin-like growth factor I deficiency (IGF1 deficiency) which is an autosomal recessive disorder characterized by growth retardation, sensorineural deafness and mental retardation.

Reference

  • Jansen M., et al.,(1983), Sequence of cDNA encoding human insulin-like growth factor I precursor. Nature 306:609-611.
  • de Pagter-Holthuizen P., et al., (1986), Organization of the human genes for insulin-like growth factors I and II.FEBS Lett. 195:179-184.
  • le Bouc Y., et al.,(1986), Complete characterization of the human IGF-I nucleotide sequence isolated from a newly constructed adult liver cDNA library.FEBS Lett. 196:108-112.