Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid(NM_007652.4)

Product Information

NCBI RefSeq: NM_007652.4

RefSeq ORF Size: 372

cDNA Description: Full length Clone DNA of Mus musculus CD59 antigen.

Gene Synonym: AA987121,Cd59,protectin,RP24-297H17.1

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse CD59a / Protectin Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid MG50724-UTLN pLV-untagged 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG50724-CFLN pLV-C-FLAG 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG50724-CHLN pLV-C-His 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG50724-CMLN pLV-C-Myc 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG50724-CYLN pLV-C-HA 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG50724-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG50724-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG50724-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG50724-NHLN pLV-SP-N-His 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG50724-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse CD59a / Protectin Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG50724-NYLN pLV-SP-N-HA 2-3 weeks

Background

Protectin, a complement regulatory protein, also known as CD59, or MIRL (membrane inhibitor of reactive lysis) is a small protein that inhibits the complement membrane attack complex by binding C5b678 and preventing C9 from binding and polymerizing. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxy-terminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins.It was found that the CD59/Protectin antigen is a small protein sometimes associated with larger components (45 and 80 kD) in urine. CD59/Protectin antigen was released from the surface of transfected COS cells by phosphatidylinositol-specific phospholipase C, demonstrating that it is attached to the cell membrane by means of a glycolipid anchor; it is therefore likely to be absent from the surface of affected erythrocytes in the disease paroxysmal nocturnal hemoglobinuria.

Reference

  • Huang Y, et al. (2006) Defining the CD59-C9 binding interaction. J Biol Chem. 281 (37): 27398-404.
  • Sawada R, et al. (1990) Isolation and expression of the full-length cDNA encoding CD59 antigen of human lymphocytes. DNA Cell Biol. 9(3): 213-20.
  • Philbrick WM, et al. (1990) The CD59 antigen is a structural homologue of murine Ly-6 antigens but lacks interferon inducibility. Eur J Immunol. 20(1): 87-92.