Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid(NM_010740.3)

Product Information

NCBI RefSeq: NM_010740.3

RefSeq ORF Size: 1935

cDNA Description: Full length Clone DNA of Mus musculus CD93 antigen.

Gene Synonym: 6030404G09Rik,AA145088,AA4.1,AW555904,C1qr1,C1qrp,Ly68

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse CD93/C1qR Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid MG50759-UTLN pLV-untagged 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG50759-CFLN pLV-C-FLAG 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG50759-CHLN pLV-C-His 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG50759-CMLN pLV-C-Myc 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG50759-CYLN pLV-C-HA 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG50759-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG50759-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG50759-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG50759-NHLN pLV-SP-N-His 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG50759-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse CD93/C1qR Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG50759-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is selectively expressed on cells of the myeloid lineage. CD93/C1qR is a highly glycosylated transmembrane protein expressed on monocytes, neutrophils, endothelial cells, and stem cells. CD93 was originally identified as a myeloid cell-surface marker and subsequently associated with an ability to modulate phagocytosis of suboptimally opsonized immunoglobulin G and complement particles in vitro. CD93/C1qR, a receptor expressed during early B-cell development, is reinduced during plasma-cell differentiation. High CD93/CD138 expression was restricted to antibody-secreting cells both in T-dependent and T-independent responses as naive, memory, and germinal-center B cells remained CD93-negative. CD93 was expressed on (pre)plasmablasts/plasma cells, including long-lived plasma cells that showed decreased cell cycle activity, high levels of isotype-switched Ig secretion, and modification of the transcriptional network. CD93 is important for the maintenance of plasma cells in bone marrow niches.

Reference

  • Bohlson SS, et al. (2005) CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol. 175(2): 1239-47.
  • Norsworthy PJ, et al. (2004) Murine CD93 (C1qRp) contributes to the removal of apoptotic cells in vivo but is not required for C1q-mediated enhancement of phagocytosis. J Immunol. 172(6): 3406-14.
  • Chevrier S, et al. (2009) CD93 is required for maintenance of antibody secretion and persistence of plasma cells in the bone marrow niche. Proc Natl Acad Sci U S A. 106(10): 3895-900.