Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid(NM_011795.2)

Product Information

NCBI RefSeq: NM_011795.2

RefSeq ORF Size: 777

cDNA Description: Full length Clone DNA of Mus musculus complement component 1, q subcomponent-like 1.

Gene Synonym: C1qrf,CRF,CTRP14,gliacolin

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse C1QL1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid MG51728-UTLN pLV-untagged 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG51728-CFLN pLV-C-FLAG 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG51728-CHLN pLV-C-His 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG51728-CMLN pLV-C-Myc 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG51728-CYLN pLV-C-HA 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG51728-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG51728-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG51728-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG51728-NHLN pLV-SP-N-His 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG51728-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse C1QL1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG51728-NYLN pLV-SP-N-HA 2-3 weeks