Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid(NM_133284.2)

Product Information

NCBI RefSeq: NM_133284.2

RefSeq ORF Size: 1179

cDNA Description: Full length Clone DNA of Rattus norvegicus progastricsin (pepsinogen C).

Gene Synonym: PG1, Pg-1, Upg1, Pgc

Species: Rat

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Rat Pepsinogen C/PGC Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid RG80097-UTLN pLV-untagged 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag RG80097-CFLN pLV-C-FLAG 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-His tag RG80097-CHLN pLV-C-His 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag RG80097-CMLN pLV-C-Myc 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-HA tag RG80097-CYLN pLV-C-HA 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag RG80097-ACGLN pLV-C-GFPSpark 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag RG80097-ACRLN pLV-C-OFPSpark 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag RG80097-NFLN pLV-SP-N-Flag 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, N-His tag RG80097-NHLN pLV-SP-N-His 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag RG80097-NMLN pLV-SP-N-Myc 2-3 weeks
Rat Pepsinogen C/PGC Gene Lentiviral ORF cDNA expression plasmid, N-HA tag RG80097-NYLN pLV-SP-N-HA 2-3 weeks

Background

Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.

Reference

  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.