Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid(NM_001127190.1)

Product Information

NCBI RefSeq: NM_001127190.1

RefSeq ORF Size: 1353

cDNA Description: Full length Clone DNA of Homo sapiens c-src tyrosine kinase.

Gene Synonym: MGC117393; CSK

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C-Src Kinase / CSK Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid HG10740-UTLN pLV-untagged 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10740-CFLN pLV-C-FLAG 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10740-CHLN pLV-C-His 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10740-CMLN pLV-C-Myc 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10740-CYLN pLV-C-HA 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10740-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10740-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10740-NFLN pLV-N-Flag 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10740-NHLN pLV-N-His 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10740-NMLN pLV-N-Myc 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10740-NYLN pLV-N-HA 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10740-ANGLN pLV-N-GFPSpark 2-3 weeks
Human C-Src Kinase / CSK Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10740-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

References

Reference

  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.