Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid(NM_006103.3)

Product Information

NCBI RefSeq: NM_006103.3

RefSeq ORF Size: 375

cDNA Description: Full length Clone DNA of Homo sapiens WAP four-disulfide core domain 2.

Gene Synonym: dJ461P17.6,EDDM4,HE4,WAP5

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human WFDC2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid HG12609-UTLN pLV-untagged 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12609-CFLN pLV-C-FLAG 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12609-CHLN pLV-C-His 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12609-CMLN pLV-C-Myc 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12609-CYLN pLV-C-HA 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12609-ACGLN pLV-C-GFPSpark 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12609-ACRLN pLV-C-OFPSpark 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12609-NFLN pLV-SP-N-Flag 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12609-NHLN pLV-SP-N-His 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12609-NMLN pLV-SP-N-Myc 2-3 weeks
Human WFDC2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12609-NYLN pLV-SP-N-HA 2-3 weeks

Background

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

Reference

  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellstr?m,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.