Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL4R Gene Lentiviral ORF cDNA expression plasmid(NM_000418.3)

Product Information

NCBI RefSeq: NM_000418.3

RefSeq ORF Size: 2478

Gene Synonym: CD124,IL-4RA,IL4R,IL4RA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL4R Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL4R Gene Lentiviral ORF cDNA expression plasmid HG10402-UTLN pLV-untagged 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10402-CFLN pLV-C-FLAG 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10402-CHLN pLV-C-His 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10402-CMLN pLV-C-Myc 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10402-CYLN pLV-C-HA 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10402-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10402-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10402-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10402-NHLN pLV-SP-N-His 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10402-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL4R Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10402-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD124, also known as interleukin 4 receptor (IL4R), is a type

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.