Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid(NM_005228.3)

Product Information

NCBI RefSeq: NM_005228.3

RefSeq ORF Size: 3633

cDNA Description: Full length Clone DNA of Homo sapiens epidermal growth factor receptor.

Gene Synonym: ERBB,ERBB1,HER1,mENA,NISBD2,PIG61

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human EGFR/HER1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid HG10001-UTLN pLV-untagged 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10001-CFLN pLV-C-FLAG 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10001-CHLN pLV-C-His 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10001-CMLN pLV-C-Myc 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10001-CYLN pLV-C-HA 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10001-ACGLN pLV-C-GFPSpark 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10001-ACRLN pLV-C-OFPSpark 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10001-NFLN pLV-SP-N-Flag 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10001-NHLN pLV-SP-N-His 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10001-NMLN pLV-SP-N-Myc 2-3 weeks
Human EGFR/HER1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10001-NYLN pLV-SP-N-HA 2-3 weeks

Background

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.