Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_004448.2)

Product Information

NCBI RefSeq: NM_004448.2

RefSeq ORF Size: 3768

cDNA Description: Full length Clone DNA of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian), transcript variant 1.

Gene Synonym: CD340,HER-2,HER-2/neu,HER2,MLN 19,MLN19,NEU,NGL,TKR1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human HER2/ERBB2 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10004-UTLN pLV-untagged 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10004-CFLN pLV-C-FLAG 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10004-CHLN pLV-C-His 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10004-CMLN pLV-C-Myc 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10004-CYLN pLV-C-HA 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10004-ACGLN pLV-C-GFPSpark 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10004-ACRLN pLV-C-OFPSpark 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10004-NFLN pLV-SP-N-Flag 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10004-NHLN pLV-SP-N-His 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10004-NMLN pLV-SP-N-Myc 2-3 weeks
Human HER2/ERBB2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10004-NYLN pLV-SP-N-HA 2-3 weeks

Background

Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.