Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_000759.2)

Product Information

NCBI RefSeq: NM_000759.2

RefSeq ORF Size: 624

cDNA Description: Full length Clone DNA of Homo sapiens colony stimulating factor 3 (granulocyte), transcript variant 1.

Gene Synonym: C17orf33,C17orf33OS,CSF3OS,G-CSF,GCSF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human G-CSF/CSF3 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10006-UTLN pLV-untagged 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10006-CFLN pLV-C-FLAG 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10006-CHLN pLV-C-His 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10006-CMLN pLV-C-Myc 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10006-CYLN pLV-C-HA 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10006-ACGLN pLV-C-GFPSpark 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10006-ACRLN pLV-C-OFPSpark 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10006-NFLN pLV-SP-N-Flag 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10006-NHLN pLV-SP-N-His 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10006-NMLN pLV-SP-N-Myc 2-3 weeks
Human G-CSF/CSF3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10006-NYLN pLV-SP-N-HA 2-3 weeks

Background

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.