Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid(NM_002253.1)

Product Information

NCBI RefSeq: NM_002253.1

RefSeq ORF Size: 4071

cDNA Description: Full length Clone DNA of Homo sapiens kinase insert domain receptor (a type I II receptor tyrosine kinase).

Gene Synonym: CD309,Flk-1,FLK1,VEGFR,VEGFR2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VEGFR2/KDR/Flk-1/CD309 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid HG10012-UTLN pLV-untagged 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10012-CFLN pLV-C-FLAG 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10012-CHLN pLV-C-His 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10012-CMLN pLV-C-Myc 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10012-CYLN pLV-C-HA 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10012-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10012-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10012-NFLN pLV-SP-N-Flag 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10012-NHLN pLV-SP-N-His 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10012-NMLN pLV-SP-N-Myc 2-3 weeks
Human VEGFR2/KDR/Flk-1/CD309 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10012-NYLN pLV-SP-N-HA 2-3 weeks

Background

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.