Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid

Product Information

RefSeq ORF Size: 468

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 1 (acidic).

Gene Synonym: AFGF,ECGF,ECGF-beta,ECGFA,ECGFB,FGF-1,FGF-alpha,FGFA,GLIO703,HBGF-1,HBGF1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human aFGF/FGF1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid HG10013-UTLN pLV-untagged 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10013-CFLN pLV-C-FLAG 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10013-CHLN pLV-C-His 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10013-CMLN pLV-C-Myc 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10013-CYLN pLV-C-HA 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10013-ACGLN pLV-C-GFPSpark 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10013-ACRLN pLV-C-OFPSpark 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10013-NFLN pLV-SP-N-Flag 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10013-NHLN pLV-SP-N-His 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10013-NMLN pLV-SP-N-Myc 2-3 weeks
Human aFGF/FGF1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10013-NYLN pLV-SP-N-HA 2-3 weeks

Background

aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted through binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.

References

Reference

  • Jaye M., et al.,(1986), Human endothelial cell growth factor: cloning, nucleotide sequence, and chromosome localization. Science 233:541-545.
  • Mergia A., et al., (1989), Structural analysis of the gene for human acidic fibroblast growth factor.Biochem. Biophys. Res. Commun. 164:1121-1129.
  • Wang W.P., et al.,(1989), Cloning of the gene coding for human class 1 heparin-binding growth factor and its expression in fetal tissues.Mol. Cell. Biol. 9:2387-2395.