Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid

Product Information

RefSeq ORF Size: 468

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 2 (basic).

Gene Synonym: BFGF,FGF-2,FGFB,HBGF-2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human bFGF/FGF2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid HG10014-UTLN pLV-untagged 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10014-CFLN pLV-C-FLAG 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10014-CHLN pLV-C-His 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10014-CMLN pLV-C-Myc 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10014-CYLN pLV-C-HA 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10014-ACGLN pLV-C-GFPSpark 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10014-ACRLN pLV-C-OFPSpark 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10014-NFLN pLV-SP-N-Flag 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10014-NHLN pLV-SP-N-His 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10014-NMLN pLV-SP-N-Myc 2-3 weeks
Human bFGF/FGF2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10014-NYLN pLV-SP-N-HA 2-3 weeks

Background

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

Reference

  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.