Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid

Product Information

RefSeq ORF Size: 435

cDNA Description: Full length Clone DNA of Homo sapiens colony stimulating factor 2(granulocyte-macrophage).

Gene Synonym: GM-CSF,GMCSF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human GM-CSF/CSF2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid HG10015-UTLN pLV-untagged 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10015-CFLN pLV-C-FLAG 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10015-CHLN pLV-C-His 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10015-CMLN pLV-C-Myc 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10015-CYLN pLV-C-HA 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10015-ACGLN pLV-C-GFPSpark 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10015-ACRLN pLV-C-OFPSpark 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10015-NFLN pLV-SP-N-Flag 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10015-NHLN pLV-SP-N-His 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10015-NMLN pLV-SP-N-Myc 2-3 weeks
Human GM-CSF/CSF2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10015-NYLN pLV-SP-N-HA 2-3 weeks

Background

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is one of an array of cytokines with pivotal roles in embryo implantation and subsequent development. Several cell lineages in the reproductive tract and gestational tissues synthesise GM-CSF under direction by ovarian steroid hormones and signalling agents originating in male seminal fluid and the conceptus. The pre-implantation embryo, invading placental trophoblast cells and the abundant populations of leukocytes controlling maternal immune tolerance are all subject to GM-CSF regulation. GM-CSF stimulates the differentiation of hematopoietic progenitors to monocytes and neutrophils, and reduces the risk for febrile neutropenia in cancer patients. GM-CSF also has been shown to induce the differentiation of myeloid dendritic cells (DCs) that promote the development of T-helper type 1 (cellular) immune responses in cognate T cells. The active form of the protein is found extracellularly as a homodimer, and the encoding gene is localized to a related gene cluster at chromosome region 5q31 which is known to be associated with 5q-syndrome and acute myelogenous leukemia. As a part of the immune/inflammatory cascade, GM-CSF promotes Th1 biased immune response, angiogenesis, allergic inflammation, and the development of autoimmunity, and thus worthy of consideration for therapeutic target. GM-CSF has been utilized in the clinical management of multiple disease processes. Most recently, GM-CSF has been incorporated into the treatment of malignancies as a sole therapy, as well as a vaccine adjuvant. While the benefits of GM-CSF in this arena have been promising, recent reports have suggested the potential for GM-CSF to induce immune suppression and, thus, negatively impact outcomes in the management of cancer patients. GM-CSF deficiency in pregnancy adversely impacts fetal and placental development, as well as progeny viability and growth after birth, highlighting this cytokine as a central maternal determinant of pregnancy outcome with clinical relevance in human fertility.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Robertson SA. (2007) GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev. 18(3-4): 287-98.
  • Waller EK. (2007) The role of sargramostim (rhGM-CSF) as immunotherapy. Oncologist. 12 Suppl 2: 22-6.
  • Clive KS, et al. (2010) Use of GM-CSF as an adjuvant with cancer vaccines: beneficial or detrimental? Expert Rev Vaccines. 9(5): 519-25.