Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid(NM_000882.2)

Product Information

NCBI RefSeq: NM_000882.2

RefSeq ORF Size: 762

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35).

Gene Synonym: CLMF,IL-12A,NFSK,NKSF1,P35

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL12A / IL-12A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid HG10021-UTLN pLV-untagged 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10021-CFLN pLV-C-FLAG 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10021-CHLN pLV-C-His 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10021-CMLN pLV-C-Myc 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10021-CYLN pLV-C-HA 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10021-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10021-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10021-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10021-NHLN pLV-SP-N-His 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10021-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL12A / IL-12A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10021-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.

Reference

  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.