Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid(NM_001242.4)

Product Information

NCBI RefSeq: NM_001242.4

RefSeq ORF Size: 783

cDNA Description: Full length Clone DNA of Homo sapiens CD27 molecule.

Gene Synonym: S152,S152. LPFS2,S152.LPFS2,T14,TNFRSF7,Tp55

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD27/TNFRSF7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid HG10039-UTLN pLV-untagged 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10039-CFLN pLV-C-FLAG 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10039-CHLN pLV-C-His 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10039-CMLN pLV-C-Myc 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10039-CYLN pLV-C-HA 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10039-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10039-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10039-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10039-NHLN pLV-SP-N-His 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10039-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD27/TNFRSF7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10039-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.