Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid(NM_001561.4)

Product Information

NCBI RefSeq: NM_001561.4

RefSeq ORF Size: 768

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 8.

Gene Synonym: 4-1BB,CD137,CDw137,ILA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human 4-1BB/TNFRSF9/CD137 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid HG10041-UTLN pLV-untagged 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10041-CFLN pLV-C-FLAG 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10041-CHLN pLV-C-His 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10041-CMLN pLV-C-Myc 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10041-CYLN pLV-C-HA 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10041-ACGLN pLV-C-GFPSpark 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10041-ACRLN pLV-C-OFPSpark 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10041-NFLN pLV-SP-N-Flag 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10041-NHLN pLV-SP-N-His 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10041-NMLN pLV-SP-N-Myc 2-3 weeks
Human 4-1BB/TNFRSF9/CD137 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10041-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Sica G, et al. (1999) Biochemical and immunological characteristics of 4-1BB (CD137) receptor and ligand and potential applications in cancer therapy. Arch Immunol Ther Exp (Warsz). 47(5): 275-9.
  • Nam KO, et al. (2005) The therapeutic potential of 4-1BB (CD137) in cancer. Curr Cancer Drug Targets. 5(5): 357-63.
  • Wang Q, et al. (2008) Analysis of CD137 and CD137L expression in human primary tumor tissues. Croat Med J. 49(2): 192-200.
  • Melero I, et al. (2008) Multi-layered action mechanisms of CD137 (4-1BB)-targeted immunotherapies. Trends Pharmacol Sci. 29(8): 383-90.
  • Thum E, et al. (2009) CD137, implications in immunity and potential for therapy. Front Biosci. 14: 4173-88.