Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid(NM_002187.2)

Product Information

NCBI RefSeq: NM_002187.2

RefSeq ORF Size: 987

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40).

Gene Synonym: CLMF,CLMF2,IL-12B,IMD28,IMD29,NKSF,NKSF2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL12B/IL-12B Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid HG10052-UTLN pLV-untagged 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10052-CFLN pLV-C-FLAG 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10052-CHLN pLV-C-His 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10052-CMLN pLV-C-Myc 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10052-CYLN pLV-C-HA 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10052-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10052-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10052-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10052-NHLN pLV-SP-N-His 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10052-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL12B/IL-12B Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10052-NYLN pLV-SP-N-HA 2-3 weeks

Background

Subunit beta of interleukin 12 (also known as natural killer cell stimulatory factor 2, or cytotoxic lymphocyte maturation factor 2, p40) (IL12B) is a subunit of human interleukin 12. IL12B/IL-12B is a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. IL12B/IL-12B is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. IL12B/IL-12B associates with IL23A to form the IL-23 interleukin, an heterodimeric cytokine which functions in innate and adaptive immunity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Taoufik Y, et al. (1997) Human immunodeficiency virus gp120 inhibits interleukin-12 secretion by human monocytes: an indirect interleukin-10-mediated effect. Blood. 89 (8): 2842-8.
  • Fantuzzi L, et al. (1996) Induction of interleukin-12 (IL-12) by recombinant glycoprotein gp120 of human immunodeficiency virus type 1 in human monocytes/macrophages: requirement of gamma interferon for IL-12 secretion. J Virol. 70 (6): 4121-4.
  • Aragane Y, et al. (1995) IL-12 is expressed and released by human keratinocytes and epidermoid carcinoma cell lines. J Immunol. 153 (12): 5366-72.