Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid(NM_006573.3)

Product Information

NCBI RefSeq: NM_006573.3

RefSeq ORF Size: 858

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 13b.

Gene Synonym: BAFF,BLYS,CD257,DTL,TALL-1,TALL1,THANK,TNFSF20,ZTNF4

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BAFF/BLyS/TNFSF13B Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid HG10056-UTLN pLV-untagged 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10056-CFLN pLV-C-FLAG 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10056-CHLN pLV-C-His 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10056-CMLN pLV-C-Myc 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10056-CYLN pLV-C-HA 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10056-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10056-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10056-NFLN pLV-SP-N-Flag 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10056-NHLN pLV-SP-N-His 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10056-NMLN pLV-SP-N-Myc 2-3 weeks
Human BAFF/BLyS/TNFSF13B Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10056-NYLN pLV-SP-N-HA 2-3 weeks

Background

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.