Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_004530.4)

Product Information

NCBI RefSeq: NM_004530.4

RefSeq ORF Size: 1983

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1.

Gene Synonym: CLG4,CLG4A,MMP-2,MMP-II,MONA,TBE-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10082-UTLN pLV-untagged 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10082-CFLN pLV-C-FLAG 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10082-CHLN pLV-C-His 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10082-CMLN pLV-C-Myc 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10082-CYLN pLV-C-HA 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10082-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10082-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10082-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10082-NHLN pLV-SP-N-His 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10082-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10082-NYLN pLV-SP-N-HA 2-3 weeks

Background

Matrix Metalloproteinase-2 (MMP-2) is an enzyme that degrades components of the extracellular matrix and thus plays a pivotal role in cell migration during physiological and pathological processes. MMP-2 expression is dependent on extracellular matrix metalloproteinase inducer (EMMPRIN), Her2/neu, growth factors, cytokines, and hormones. Pro-MMP-2 activation needs MT1-MMP and TIMP-2 contribution. MMP-2 is changed in distribution and increased in amount in the ventral cochlear nucleus after unilateral cochlear ablation. A low level of MMP-2 is linked to favorable prognosis in patients with a hormone receptor-negative tumor, usually associated with high risk. As a zymogen requiring proteolytic activation for catalytic activity, MMP-2 has been implicated broadly in the invasion and metastasis of many cancer model systems, including human breast cancer (HBC). Blocking MMP-2 secretion and activation during breast carcinoma development may decrease metastasis. The detection of active MMP-2 alone or the rate of pro-MMP-2 and active MMP-2 is considered a very sensitive indicator of cancer metastasis. Modulation of MMP-2 expression and activation through specific inhibitors and activators may thus provide a new mechanism for breast cancer treatment.

Reference

  • Thompson EW, et al. (1994) Collagen induced MMP-2 activation in human breast cancer. Breast Cancer Res Treat. 31(2-3): 357-70.
  • Jezierska A, et al. (2009) Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. 15(2): RA32-40.
  • Fredrich M, et al. (2010) MMP-2 is involved in synaptic remodeling after cochlear lesion. Neuroreport. 21(5): 324-7.