Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid(NM_014143.2)

Product Information

NCBI RefSeq: NM_014143.2

RefSeq ORF Size: 873

cDNA Description: Full length Clone DNA of Homo sapiens CD274 molecule.

Gene Synonym: B7-H,B7-H1,B7H1,PD-L1,PDCD1L1,PDCD1LG1,PDL1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PD-L1/B7-H1/CD274 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid HG10084-UTLN pLV-untagged 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10084-CFLN pLV-C-FLAG 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10084-CHLN pLV-C-His 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10084-CMLN pLV-C-Myc 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10084-CYLN pLV-C-HA 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10084-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10084-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10084-NFLN pLV-SP-N-Flag 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10084-NHLN pLV-SP-N-His 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10084-NMLN pLV-SP-N-Myc 2-3 weeks
Human PD-L1/B7-H1/CD274 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10084-NYLN pLV-SP-N-HA 2-3 weeks

Background

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

Immune Checkpoint
Immune Checkpoint Blockade: Blocking Antibodies   Immune Checkpoint Blockade: PD-L1 / B7-H1 / CD274 Blocking Antibodies
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   PD-L1 / B7-H1 / CD274 Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.