Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_000574.3)

Product Information

NCBI RefSeq: NM_000574.3

RefSeq ORF Size: 1146

cDNA Description: Full length Clone DNA of Homo sapiens CD55 molecule, decay accelerating factor for complement (Cromer blood group), transcript variant 1.

Gene Synonym: CR,CROM,DAF,TC

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD55/DAF transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10101-UTLN pLV-untagged 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10101-CFLN pLV-C-FLAG 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10101-CHLN pLV-C-His 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10101-CMLN pLV-C-Myc 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10101-CYLN pLV-C-HA 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10101-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10101-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10101-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10101-NHLN pLV-SP-N-His 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10101-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD55/DAF transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10101-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

Reference

  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.