Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001078.2)

Product Information

NCBI RefSeq: NM_001078.2

RefSeq ORF Size: 2220

cDNA Description: Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1.

Gene Synonym: CD106,INCAM-100,VCAM-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10113-UTLN pLV-untagged 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10113-CFLN pLV-C-FLAG 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10113-CHLN pLV-C-His 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10113-CMLN pLV-C-Myc 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10113-CYLN pLV-C-HA 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10113-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10113-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10113-NFLN pLV-SP-N-Flag 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10113-NHLN pLV-SP-N-His 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10113-NMLN pLV-SP-N-Myc 2-3 weeks
Human VCAM1/VCAM-1/CD106 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10113-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.