Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_000609.4)

Product Information

NCBI RefSeq: NM_000609.4

RefSeq ORF Size: 282

cDNA Description: Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1), transcript variant 2.

Gene Synonym: IRH,PBSF,SCYB12,SDF-1,SDF1,TLSF,TPAR1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human SDF-1/CXCL12 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10118-UTLN pLV-untagged 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10118-CFLN pLV-C-FLAG 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10118-CHLN pLV-C-His 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10118-CMLN pLV-C-Myc 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10118-CYLN pLV-C-HA 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10118-ACGLN pLV-C-GFPSpark 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10118-ACRLN pLV-C-OFPSpark 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10118-NFLN pLV-SP-N-Flag 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10118-NHLN pLV-SP-N-His 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10118-NMLN pLV-SP-N-Myc 2-3 weeks
Human SDF-1/CXCL12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10118-NYLN pLV-SP-N-HA 2-3 weeks

Background

The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine belonging to the large family of CXC chemokines. SDF1 is expressed in two isoforms from a single gene that encodes two splice variants, SDF1α and SDF1β, which are identical except for the four residues present in the C-terminus of SDF1β but absent from SDF1α. The chemokine CXCL12 [stromal cell-derived factor-1 (SDF-1)] binds primarily to CXC receptor 4 (CXCR4; CD184). The binding of CXCL12 to CXCR4 induces intracellular signaling through several divergent pathways initiating signals related to chemotaxis, cell survival and/or proliferation, increase in intracellular calcium, and gene transcription. CXCL12 and CXCR4 that have been widely characterized in peripheral tissues and delineate their main functions in the CNS. Extensive evidence supports CXCL12 as a key regulator for early development of the CNS. In the mature CNS, CXCL12 modulates neurotransmission, neurotoxicity and neuroglial interactions. CXCL12 has crucial roles in the formation of multiple organ systems during embryogenesis and in the regulation of bone marrow haematopoiesis and immune function in the postnatal organism. Although considered an important factor in normal bone metabolism, recent studies implicate CXCL12 in the pathogenesis of several diseases involving the skeleton, including rheumatoid arthritis and cancers that metastasize to bone. The CXCL12/CXCR4 axis is involved in tumor progression, angiogenesis, metastasis, and survival. Pathologically enhanced CXCL12 signaling may promote the formation of new vessels through recruiting circulating endothelial progenitor cells or directly enhancing the migration/growth of endothelial cells. Therefore, CXCL12 signaling represents an important mechanism that regulates brain tumor angiogenesis/vasculogenesis and may provide potential targets for anti-angiogenic therapy in malignant gliomas.

Reference

  • Bleul, C.C. et al., 1996, Nature. 382: 829-833.
  • Sapede, D. et al., 2005, Proc. Natl. Acad. Sci. USA. 102: 1714-1718.
  • Delgado, M.B. et al., 2001, Eur. J. Immunol. 31: 699-707.
  • Orimo, A. et al., 2005, Cell. 121: 335-348.
  • Kryczek, I. et al., 2007, Am. J. Physiol. Cell. Physiol. 292: C987-995.
  • Bbalabanian, K. et al., 2005, J. Biol. Chem. 280: 35760-35766.