Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid(NM_000575.3)

Product Information

NCBI RefSeq: NM_000575.3

RefSeq ORF Size: 816

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 1, alpha.

Gene Synonym: IL-1A,IL-1F1,IL1,IL1-ALPHA,IL1F1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL1A/IL-1A/IL-1F1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid HG10128-UTLN pLV-untagged 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10128-CFLN pLV-C-FLAG 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10128-CHLN pLV-C-His 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10128-CMLN pLV-C-Myc 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10128-CYLN pLV-C-HA 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10128-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10128-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10128-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10128-NHLN pLV-SP-N-His 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10128-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL1A/IL-1A/IL-1F1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10128-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.