Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid(NM_002019.2)

Product Information

NCBI RefSeq: NM_002019.2

RefSeq ORF Size: 4017

cDNA Description: Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor).

Gene Synonym: FLT,FLT-1,VEGFR-1,VEGFR1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VEGFR1/FLT-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid HG10136-UTLN pLV-untagged 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10136-CFLN pLV-C-FLAG 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10136-CHLN pLV-C-His 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10136-CMLN pLV-C-Myc 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10136-CYLN pLV-C-HA 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10136-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10136-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10136-NFLN pLV-SP-N-Flag 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10136-NHLN pLV-SP-N-His 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10136-NMLN pLV-SP-N-Myc 2-3 weeks
Human VEGFR1/FLT-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10136-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein kinase receptor FLT, Vascular permeability factor receptor and FLT1, is a single-pass type I membrane protein and secreted protein which belongs to the protein kinase superfamily, Tyr protein kinase family and CSF-1/PDGF receptor subfamily. VEGFR-1 / FLT1 contains seven Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. VEGFR-1 / FLT1 is expressed mostly in normal lung, but also in placenta, liver, kidney, heart and brain tissues. It is specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. VEGFR-1 / FLT1 is not expressed in tumor cell lines. VEGFR-1 / FLT1 is an essential receptor tyrosine kinase that regulates mammalian vascular development and embryogenesis. EGF-induced angiogenesis requires inverse regulation of VEGFR-1 and VEGFR-2 in tumor-associated endothelial cells. VEGFR-1 / FLT1 is a receptor for VEGF, VEGFB and PGF. It has a tyrosine-protein kinase activity. The VEGF-kinase ligand/receptor signaling system plays a key role in vascular development and regulation of vascular permeability.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Shibuya M., et al.,(1990), Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. Oncogene 5:519-524.
  • Kendall R.L., et al., (1993), Inhibition of vascular endothelial cell growth factor activity by an endogenously encoded soluble receptor.Proc. Natl. Acad. Sci. U.S.A. 90:10705-10709.
  • Herley M.T., et al.,(1999), Characterization of the VEGF binding site on the Flt-1 receptor.Biochem. Biophys. Res. Commun. 262:731-738.