Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid(NM_000576.2)

Product Information

NCBI RefSeq: NM_000576.2

RefSeq ORF Size: 810

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 1, beta (IL1B).

Gene Synonym: IL-1,IL-1 beta,IL-1B,IL1-BETA,IL1F2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL1B/IL-1B/IL-1 beta Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid HG10139-UTLN pLV-untagged 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10139-CFLN pLV-C-FLAG 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10139-CHLN pLV-C-His 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10139-CMLN pLV-C-Myc 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10139-CYLN pLV-C-HA 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10139-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10139-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10139-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10139-NHLN pLV-SP-N-His 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10139-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL1B/IL-1B/IL-1 beta Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10139-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.