Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_138554.2)

Product Information

NCBI RefSeq: NM_138554.2

RefSeq ORF Size: 2520

cDNA Description: Full length Clone DNA of Homo sapiens toll-like receptor 4, transcript variant 1.

Gene Synonym: ARMD10,CD284,TLR-4,TLR4,TOLL

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TLR4 / TLR-4 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10146-UTLN pLV-untagged 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10146-CFLN pLV-C-FLAG 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10146-CHLN pLV-C-His 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10146-CMLN pLV-C-Myc 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10146-CYLN pLV-C-HA 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10146-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10146-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10146-NFLN pLV-SP-N-Flag 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10146-NHLN pLV-SP-N-His 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10146-NMLN pLV-SP-N-Myc 2-3 weeks
Human TLR4 / TLR-4 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10146-NYLN pLV-SP-N-HA 2-3 weeks

Background

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

Reference

  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.