Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001114753.1)

Product Information

NCBI RefSeq: NM_001114753.1

RefSeq ORF Size: 1977

cDNA Description: Full length Clone DNA of Homo sapiens endoglin (ENG), transcript variant 1.

Gene Synonym: END,HHT1,ORW1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Endoglin/CD105 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10149-UTLN pLV-untagged 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10149-CFLN pLV-C-FLAG 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10149-CHLN pLV-C-His 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10149-CMLN pLV-C-Myc 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10149-CYLN pLV-C-HA 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10149-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10149-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10149-NFLN pLV-SP-N-Flag 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10149-NHLN pLV-SP-N-His 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10149-NMLN pLV-SP-N-Myc 2-3 weeks
Human Endoglin/CD105 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10149-NYLN pLV-SP-N-HA 2-3 weeks

Background

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-

Reference

  • Bellon T., et al.,(1993), Identification and expression of two forms of the human transforming growth factor-beta-binding protein endoglin with distinct cytoplasmic regions. Eur. J. Immunol. 23:2340-2345.
  • Humphray S.J., et al., (2004), DNA sequence and analysis of human chromosome 9.Nature 429:369-374.
  • Gougos A., et al.,(1990), Primary structure of endoglin, an RGD-containing glycoprotein of human endothelial cells.J. Biol. Chem. 265:8361-8364.