Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid(NM_001928.2)

Product Information

NCBI RefSeq: NM_001928.2

RefSeq ORF Size: 687

cDNA Description: Full length Clone DNA of Homo sapiens complement factor D (adipsin).

Gene Synonym: ADIPSIN,ADN,DF,FACTOR D,PFD

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FACTOR D/Adipsin Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid HG10160-UTLN pLV-untagged 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10160-CFLN pLV-C-FLAG 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10160-CHLN pLV-C-His 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10160-CMLN pLV-C-Myc 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10160-CYLN pLV-C-HA 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10160-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10160-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10160-NFLN pLV-SP-N-Flag 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10160-NHLN pLV-SP-N-His 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10160-NMLN pLV-SP-N-Myc 2-3 weeks
Human FACTOR D/Adipsin Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10160-NYLN pLV-SP-N-HA 2-3 weeks

Background

Mouse complement factor D, also known as Adipsin, C3 convertase activator, Properdin factor D and CFD is a secreted protein which belongs to the peptidase S1 family. CFD / Adipsin contains one peptidase S1 domain. Complement factor D ( CFD / Adipsin ) is a component of the alternative complement pathway best known for its role in humoral suppression of infectious agents. Complement factor D ( CFD / Adipsin ) has a high level of expression in fat, suggesting a role for adipose tissue in immune system biology. This protein is also a serine protease that is secreted by adipocytes into the bloodstream. Complement factor D ( CFD / Adipsin ) cleaves factor B when the latter is complexed with factor C3b, activating the C3bbb complex, which then becomes the C3 convertase of the alternate pathway. Its function is homologous to that of C1s in the classical pathway. Complement factor D ( CFD / Adipsin ) is a serine protease that stimulates glucose transport for triglyceride accumulation in fats cells and inhibits lipolysis. Defects in CFD / Adipsin are the cause of complement factor D deficiency (CFD deficiency) which predisposes to invasive meningococcal disease.

Reference

  • Volanakis JE, et al.,1996, Protein Sci. 5 (4): 553-64.
  • Searfoss,G.H et al., 2003, J Biol Chem. 278 (46):46107-16.
  • Ukkola,O. et al., 2003, Eur J Clin Nutr. 57 (9):1073-8.
  • Ronti T, et al., 2006, Clin. Endocrinol. (Oxf) 64 (4): 355-65.