Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid(NM_005211.3)

Product Information

NCBI RefSeq: NM_005211.3

RefSeq ORF Size: 2919

cDNA Description: Full length Clone DNA of Homo sapiens colony stimulating factor 1receptor (CSF1R).

Gene Synonym: C-FMS,CD115,CSF-1R,CSFR,FIM2,FMS,HDLS,M-CSF-R,MCSF Receptor

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MCSF Receptor/CSF1R/CD115 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid HG10161-UTLN pLV-untagged 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10161-CFLN pLV-C-FLAG 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10161-CHLN pLV-C-His 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10161-CMLN pLV-C-Myc 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10161-CYLN pLV-C-HA 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10161-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10161-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10161-NFLN pLV-SP-N-Flag 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10161-NHLN pLV-SP-N-His 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10161-NMLN pLV-SP-N-Myc 2-3 weeks
Human MCSF Receptor/CSF1R/CD115 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10161-NYLN pLV-SP-N-HA 2-3 weeks

Background

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

Reference

  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.