Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid(NM_000875.3)

Product Information

NCBI RefSeq: NM_000875.3

RefSeq ORF Size: 4104

cDNA Description: Full length Clone DNA of Homo sapiens insulin-like growth factor 1 receptor.

Gene Synonym: CD221,IGF-I R,IGFIR,IGFR,JTK13

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IGF1R/CD221/IGF-I R Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid HG10164-UTLN pLV-untagged 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10164-CFLN pLV-C-FLAG 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10164-CHLN pLV-C-His 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10164-CMLN pLV-C-Myc 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10164-CYLN pLV-C-HA 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10164-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10164-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10164-NFLN pLV-SP-N-Flag 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10164-NHLN pLV-SP-N-His 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10164-NMLN pLV-SP-N-Myc 2-3 weeks
Human IGF1R/CD221/IGF-I R Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10164-NYLN pLV-SP-N-HA 2-3 weeks

Background

The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.
  • Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.
  • Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.
  • Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.