Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid(NM_000417.1)

Product Information

NCBI RefSeq: NM_000417.1

RefSeq ORF Size: 819

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 2 receptor, alpha (IL2RA).

Gene Synonym: CD25,IDDM10,IL-2RA,IL2R,p55,TCGFR

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL2RA/IL-2RA/CD25 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid HG10165-UTLN pLV-untagged 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10165-CFLN pLV-C-FLAG 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10165-CHLN pLV-C-His 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10165-CMLN pLV-C-Myc 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10165-CYLN pLV-C-HA 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10165-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10165-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10165-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10165-NHLN pLV-SP-N-His 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10165-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL2RA/IL-2RA/CD25 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10165-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.