Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid(NM_012242.2)

Product Information

NCBI RefSeq: NM_012242.2

RefSeq ORF Size: 795

cDNA Description: Full length Clone DNA of Homo sapiens dickkopf homolog 1 (Xenopus laevis).

Gene Synonym: DKK-1,SK

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human DKK1/Dkk-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid HG10170-UTLN pLV-untagged 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10170-CFLN pLV-C-FLAG 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10170-CHLN pLV-C-His 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10170-CMLN pLV-C-Myc 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10170-CYLN pLV-C-HA 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10170-ACGLN pLV-C-GFPSpark 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10170-ACRLN pLV-C-OFPSpark 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10170-NFLN pLV-SP-N-Flag 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10170-NHLN pLV-SP-N-His 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10170-NMLN pLV-SP-N-Myc 2-3 weeks
Human DKK1/Dkk-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10170-NYLN pLV-SP-N-HA 2-3 weeks

Background

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

Reference

  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.