Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid(NM_019074.2)

Product Information

NCBI RefSeq: NM_019074.2

RefSeq ORF Size: 2058

cDNA Description: Full length Clone DNA of Homo sapiens delta-like 4 (Drosophila).

Gene Synonym: Delta-like 4,hdelta2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human DLL4/Delta-like 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid HG10171-UTLN pLV-untagged 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10171-CFLN pLV-C-FLAG 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10171-CHLN pLV-C-His 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10171-CMLN pLV-C-Myc 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10171-CYLN pLV-C-HA 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10171-ACGLN pLV-C-GFPSpark 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10171-ACRLN pLV-C-OFPSpark 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10171-NFLN pLV-SP-N-Flag 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10171-NHLN pLV-SP-N-His 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10171-NMLN pLV-SP-N-Myc 2-3 weeks
Human DLL4/Delta-like 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10171-NYLN pLV-SP-N-HA 2-3 weeks

Background

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

Reference

  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.