Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_198589.1)

Product Information

NCBI RefSeq: NM_198589.1

RefSeq ORF Size: 810

cDNA Description: Full length Clone DNA of Homo sapiens basigin (Ok blood group) (BSG), transcript variant 2.

Gene Synonym: 5F7,Basigin,CD147,EMMPRIN,M6,OK,TCSF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10186-UTLN pLV-untagged 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10186-CFLN pLV-C-FLAG 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10186-CHLN pLV-C-His 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10186-CMLN pLV-C-Myc 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10186-CYLN pLV-C-HA 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10186-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10186-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10186-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10186-NHLN pLV-SP-N-His 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10186-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD147/EMMPRIN/Basigin transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10186-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.

Reference

  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.