Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001982.2)

Product Information

NCBI RefSeq: NM_001982.2

RefSeq ORF Size: 4029

cDNA Description: Full length Clone DNA of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) , transcript variant 1.

Gene Synonym: c-erbB-3,c-erbB3,EEBB3,ErbB-3,erbB3-S,HER3,LCCS2,MDA-BF-1,p180-ErbB3,p45-sErbB3,p85-sErbB3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ERBB3/HER3 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10201-UTLN pLV-untagged 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10201-CFLN pLV-C-FLAG 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10201-CHLN pLV-C-His 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10201-CMLN pLV-C-Myc 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10201-CYLN pLV-C-HA 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10201-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10201-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10201-NFLN pLV-SP-N-Flag 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10201-NHLN pLV-SP-N-His 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10201-NMLN pLV-SP-N-Myc 2-3 weeks
Human ERBB3/HER3 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10201-NYLN pLV-SP-N-HA 2-3 weeks

Background

ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Kraus M.H., et al.,(1989), Isolation and characterization of ERBB3, a third member of the ERBB/epidermal growth factor receptor family: evidence for overexpression in a subset of human mammary tumors. Proc. Natl. Acad. Sci. U.S.A. 86:9193-9197.
  • Plowman G.D., et al., (1990), Molecular cloning and expression of an additional epidermal growth factor receptor-related gene.Proc. Natl. Acad. Sci. U.S.A. 87:4905-4909.
  • Katoh M., et al.,(1993), c-erbB3 gene encodes secreted as well as transmembrane receptor tyrosine kinase.Biochem. Biophys. Res. Commun. 192:1189-1197.