Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid(NM_004360.3)

Product Information

NCBI RefSeq: NM_004360.3

RefSeq ORF Size: 2649

cDNA Description: Full length Clone DNA of Homo sapiens cadherin 1, type 1, E-cadherin (epithelial) (CDH1).

Gene Synonym: Arc-1,CD324,CDHE,E-cad,E-Cadherin,ECAD,LCAM,UVO

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human E-Cadherin/CDH1/E-cad/CD324 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid HG10204-UTLN pLV-untagged 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10204-CFLN pLV-C-FLAG 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10204-CHLN pLV-C-His 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10204-CMLN pLV-C-Myc 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10204-CYLN pLV-C-HA 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10204-ACGLN pLV-C-GFPSpark 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10204-ACRLN pLV-C-OFPSpark 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10204-NFLN pLV-SP-N-Flag 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10204-NHLN pLV-SP-N-His 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10204-NMLN pLV-SP-N-Myc 2-3 weeks
Human E-Cadherin/CDH1/E-cad/CD324 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10204-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

Reference

  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.