Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid(NM_001238.1)

Product Information

NCBI RefSeq: NM_001238.1

RefSeq ORF Size: 1233

cDNA Description: Full length Clone DNA of Homo sapiens cyclin E1.

Gene Synonym: CCNE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Cyclin E1/CCNE1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid HG10902-UTLN pLV-untagged 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10902-CFLN pLV-C-FLAG 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10902-CHLN pLV-C-His 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10902-CMLN pLV-C-Myc 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10902-CYLN pLV-C-HA 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10902-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10902-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10902-NFLN pLV-N-Flag 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10902-NHLN pLV-N-His 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10902-NMLN pLV-N-Myc 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10902-NYLN pLV-N-HA 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10902-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Cyclin E1/CCNE1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10902-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin that functions as a regulator of S phase entry and progression in mammalian cells. Cyclin E1 serves as regulatory subunits that bind, activate, and provide substrate for its associated cyclin-dependent kinase2 (CDK2), whose activity is essential for cell cycle G1 / S transition. Over expression of this encoding gene has been found in many tumors, which results in chromosome instability and by extension, induce tumorigenesis. This protein was also found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. In general, cyclin E1, as an activator of phospho-CDK2 (pCDK2), is important for cell cycle progression and is frequently overexpressed in cancer cells.

Reference

  • Honda R, et al. (2005) The structure of cyclin E1 / CDK2: implications for CDK2 activation and CDK2-independent roles. The EMBO Journal. 24: 452-63.
  • Geng Y, et al. (2007) Kinase-Independent Function of Cyclin E. 25(1): 127-39.