Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001014796.1)

Product Information

NCBI RefSeq: NM_001014796.1

RefSeq ORF Size: 2568

cDNA Description: Full length Clone DNA of Homo sapiens discoidin domain receptor tyrosine kinase 2, transcript variant 1.

Gene Synonym: MIG20a,NTRKR3,TKT,TYRO10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human DDR2/CD167b transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10209-UTLN pLV-untagged 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10209-CFLN pLV-C-FLAG 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10209-CHLN pLV-C-His 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10209-CMLN pLV-C-Myc 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10209-CYLN pLV-C-HA 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10209-ACGLN pLV-C-GFPSpark 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10209-ACRLN pLV-C-OFPSpark 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10209-NFLN pLV-SP-N-Flag 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10209-NHLN pLV-SP-N-His 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10209-NMLN pLV-SP-N-Myc 2-3 weeks
Human DDR2/CD167b transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10209-NYLN pLV-SP-N-HA 2-3 weeks

Background

Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases associated with cell proliferation and tumor metastasis, and collagen, identified as a ligand for DDR2, up-regulates matrix metallloproteinase 1 (MMP-1) and MMP-2 expression in cellular matrix. DDR2/CD167b was found to recognise the triple-helical region of collagen X as well as the NC1 domain. Binding to the collagenous region was dependent on the triple-helical conformation. DDR2/CD167b autophosphorylation was induced by the collagen X triple-helical region but not the NC1 domain, indicating that the triple-helical region of collagen X contains a specific DDR2 binding site that is capable of receptor activation. DDR2/CD167b is induced during stellate cell activation and implicate the phosphorylated receptor as a mediator of MMP-2 release and growth stimulation in response to type I collagen. Moreover, type I collagen-dependent upregulation of DDR2/CD167b expression establishes a positive feedback loop in activated stellate cells, leading to further proliferation and enhanced invasive activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Olaso E, et al. (2001) DDR2 receptor promotes MMP-2-mediated proliferation and invasion by hepatic stellate cells. J Clin Invest. 108(9): 1369-78.
  • Zhang W, et al. (2006) Expression of discoidin domain receptor 2 (DDR2) extracellular domain in pichia pastoris and functional analysis in synovial fibroblasts and NIT3T3 cells. Mol Cell Biochem. 290(1-2): 43-53.
  • Leitinger B, et al. (2006) The discoidin domain receptor DDR2 is a receptor for type X collagen. Matrix Biol. 25(6): 355-64.
  • Leitinger B, et al. (2004) The D2 period of collagen II contains a specific binding site for the human discoidin domain receptor, DDR2. J Mol Biol. 344(4): 993-1003.