Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid(NM_002009.2)

Product Information

NCBI RefSeq: NM_002009.2

RefSeq ORF Size: 579

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 7 (keratinocyte growth factor).

Gene Synonym: HBGF-7,KGF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF7 / FGF-7 / KGF Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid HG10210-UTLN pLV-untagged 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10210-CFLN pLV-C-FLAG 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10210-CHLN pLV-C-His 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10210-CMLN pLV-C-Myc 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10210-CYLN pLV-C-HA 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10210-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10210-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10210-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10210-NHLN pLV-SP-N-His 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10210-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF7 / FGF-7 / KGF Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10210-NYLN pLV-SP-N-HA 2-3 weeks