Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid(NM_001106.3)

Product Information

NCBI RefSeq: NM_001106.3

RefSeq ORF Size: 1539

cDNA Description: Full length Clone DNA of Homo sapiens activin A receptor, type I IB.

Gene Synonym: Activin RIIB,ActR-IIB,ACTRIIB,HTX4

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ACVR2B/Activin RIIB Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid HG10229-UTLN pLV-untagged 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10229-CFLN pLV-C-FLAG 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10229-CHLN pLV-C-His 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10229-CMLN pLV-C-Myc 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10229-CYLN pLV-C-HA 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10229-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10229-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10229-NFLN pLV-SP-N-Flag 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10229-NHLN pLV-SP-N-His 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10229-NMLN pLV-SP-N-Myc 2-3 weeks
Human ACVR2B/Activin RIIB Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10229-NYLN pLV-SP-N-HA 2-3 weeks

Background

ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the activin and myostatin signaling pathway. Ligands such as activin and myostatin bind to ACVR2A and ACVR2B. Myostatin, a negative regulator of skeletal muscle growth, is regarded as a potential therapeutic target and binds to ACVR2B effectively, and to a lesser extent, to ACVR2A. The structure of human ACVR2B kinase domain in complex with adenine establishes the conserved bilobal architecture consistent with all other catalytic kinase domains. Haplotype structure at the ACVR2B and follistatin loci may contribute to interindividual variation in skeletal muscle mass and strength. Defects in ACVR2B are a cause of left-right axis malformations.

Reference

    1. Kosaki R, et al. (1999) Left-right axis malformations associated with mutations in ACVR2B, the gene for human activin receptor type IIB. Am J Med Genet. 82(1):70-6.
    2. Dupont S, et al. (2001) No evidence for linkage or for diabetes-associated mutations in the activin type 2B receptor gene (ACVR2B) in French patients with mature-onset diabetes of the young or type 2 diabetes. Diabetes 50(5):1219-21.
    3. Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
    4. Walsh S, et al. (2007) Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J Appl Physiol. 102(6):2142-8.